From 29d6c6aeddb3db46c99433568b1fa8d367fc1a0c Mon Sep 17 00:00:00 2001
From: =?UTF-8?q?Michal=20Petrovi=C4=8D?= <mifo.petrovic@gmail.com>
Date: Sat, 8 Feb 2025 21:24:57 +0100
Subject: [PATCH] remove unused tests
---
.../services/G4HunterServiceTest.groovy | 4 -
.../P53PredictorAnalyseTest.groovy | 4 -
...alindromeModelAnalyseControllerTest.groovy | 113 ----------------
.../AtatPalindromeModelDetectorTest.groovy | 99 --------------
...ompositePalindromeModelDetectorTest.groovy | 126 ------------------
.../palindrome/detector/PalindromeTest.groovy | 41 ------
.../detector/SequenceTestSupport.groovy | 40 ------
.../Simple2PalindromeDetectorTest.groovy | 91 -------------
.../SimplePalindromeDetectorTest.groovy | 74 ----------
.../palindrome/model/NumberRangeTest.groovy | 32 -----
.../NNModelStabilityCalculatorTest.groovy | 25 ----
11 files changed, 649 deletions(-)
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/api/PalindromeModelAnalyseControllerTest.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/AtatPalindromeModelDetectorTest.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/CompositePalindromeModelDetectorTest.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/PalindromeTest.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SequenceTestSupport.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/Simple2PalindromeDetectorTest.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SimplePalindromeDetectorTest.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/model/NumberRangeTest.groovy
delete mode 100644 src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/stability/NNModelStabilityCalculatorTest.groovy
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/g4hunter/services/G4HunterServiceTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/g4hunter/services/G4HunterServiceTest.groovy
index 4367bd3..e2d04d2 100644
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/g4hunter/services/G4HunterServiceTest.groovy
+++ b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/g4hunter/services/G4HunterServiceTest.groovy
@@ -4,7 +4,6 @@ import cz.mendelu.dnaAnalyser.analyse.g4hunter.G4Hunter
import cz.mendelu.dnaAnalyser.analyse.g4hunter.G4HunterRepository
import cz.mendelu.dnaAnalyser.analyse.g4hunter.G4HunterService
import cz.mendelu.dnaAnalyser.analyse.g4hunter.quadruplex.Quadruplex
-import cz.mendelu.dnaAnalyser.analyse.palindrome.detector.SequenceTestSupport
import cz.mendelu.dnaAnalyser.sequence.NucleicBuffer
import cz.mendelu.dnaAnalyser.sequence.data.SequenceData
import spock.lang.Ignore
@@ -13,9 +12,6 @@ import spock.lang.Unroll
class G4HunterServiceTest extends Specification {
- static {
- SequenceTestSupport.stringAsSequence()
- }
G4HunterService g4HunterAnalyseService
G4HunterRepository g4HunterAnalyseRepository;
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/p53predictor/P53PredictorAnalyseTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/p53predictor/P53PredictorAnalyseTest.groovy
index 684f327..25ac32e 100644
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/p53predictor/P53PredictorAnalyseTest.groovy
+++ b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/p53predictor/P53PredictorAnalyseTest.groovy
@@ -1,15 +1,11 @@
package cz.mendelu.dnaAnalyser.analyse.p53predictor
-import cz.mendelu.dnaAnalyser.analyse.palindrome.detector.SequenceTestSupport
import cz.mendelu.dnaAnalyser.sequence.stream.BufferedWindow
import spock.lang.Specification
import spock.lang.Unroll
class P53PredictorAnalyseTest extends Specification {
- static {
- SequenceTestSupport.stringAsSequence()
- }
private P53PredictorAnalyse p53PredictorAnalyse
def setup() {
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/api/PalindromeModelAnalyseControllerTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/api/PalindromeModelAnalyseControllerTest.groovy
deleted file mode 100644
index 0618ed9..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/api/PalindromeModelAnalyseControllerTest.groovy
+++ /dev/null
@@ -1,113 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.api
-
-import cz.mendelu.dnaAnalyser.analyse.palindrome.PalindromeAnalyseController
-import cz.mendelu.dnaAnalyser.utils.api.ApiRestTemplate
-import cz.mendelu.dnaAnalyser.utils.controller.PaginationParam
-import cz.mendelu.dnaAnalyser.utils.controller.SortParam
-import cz.mendelu.dnaAnalyser.utils.controller.TagModifyRequest
-import org.springframework.beans.factory.annotation.Autowired
-import org.springframework.boot.test.context.SpringBootTest
-import org.springframework.http.HttpStatus
-import org.springframework.test.context.ActiveProfiles
-import spock.lang.Ignore
-import spock.lang.Specification
-
-import static org.springframework.boot.test.context.SpringBootTest.WebEnvironment.RANDOM_PORT
-
-@SpringBootTest(webEnvironment = RANDOM_PORT)
-@ActiveProfiles("test")
-class PalindromeModelAnalyseControllerTest extends Specification {
-
- @Autowired
- ApiRestTemplate api
-
- def setup() {
- api.authentication('user@mendelu.cz', 'user')
- }
-
-
- @Ignore
- def "GET:/api/analyse/palindrome Get page with palindrome analysis"(){
- when:
- def response = api.get("/api/cruciform}")
-
- then:
- response.status == 200
- }
-
- @Ignore
- def "GET:/api/analyse/palindrome/tags Get all tags defined for sequences"(){
- setup:
- def paginationParam = new PaginationParam()
- def sortParam = new SortParam()
-
- when:
- def response = api.get("/api/analyse/palindrome/$sortParam/$paginationParam") //Tohle asi nebude OK
-
- then:
- response.status == 200
- }
-
- @Ignore
- def "GET:/api/analyse/palindrome/{id} Get one palindrome by ID"(){
- setup:
- def id = UUID.randomUUID()
-
- when:
- def response = api.get("/api/sequence/${id}")
-
- then:
- response.status == 200
-
- }
-
- @Ignore
- def "POST:/api/analyse/palindrome Create palindrome analyze."(){
- given:
- def request = new PalindromeAnalyseController.PalindromeAnalyseRequest(
- sequences: [UUID.fromString('987acc67-5714-47b1-b56f-1dc56ded7c87')]
- )
-
- when:
- def response = api.post("/api/analyse/palindrome", request)
-
- then:
- response.status == HttpStatus.CREATED
- response.body.size == 1
- and:
- def uuid = response.body.items[0].id
- response.body.batches[uuid] != null
- }
-
- @Ignore
- def "GET:/api/analyse/palindrome/{id}/tags Modify tags"(){
- setup:
- def id = UUID.fromString("987acc67-5714-47b1-b56f-1dc56ded7c87")
- def request = new TagModifyRequest(
- tags: ['new tags']
- )
-
- when:
- def response = api.put("/api/analyse/palindrome/${id}/tags", request)
-
- then:
- response.status == HttpStatus.ACCEPTED.value()
-
- and:
- def payload = response.body.payload
- payload.tags == ['new tags']
- }
-
- @Ignore
- def "DELETE:/api/analyse/palindrome/{id} Delete one palindrome analyze by ID"(){
- setup:
- def id = UUID.randomUUID()
-
- when:
- def response = api.delete("/api/analyse/palindrome/${id}")
-
- then:
- response.status == 204
- }
-
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/AtatPalindromeModelDetectorTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/AtatPalindromeModelDetectorTest.groovy
deleted file mode 100644
index 8163f31..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/AtatPalindromeModelDetectorTest.groovy
+++ /dev/null
@@ -1,99 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.detector
-
-import cz.mendelu.dnaAnalyser.analyse.palindrome.model.PalindromeModel
-import cz.mendelu.dnaAnalyser.sequence.NucleicBuffer
-import cz.mendelu.dnaAnalyser.sequence.data.SequenceData
-
-/**
- * Created by xkoloma1 on 03.03.2016.
- */
-class AtatPalindromeModelDetectorTest extends groovy.util.GroovyTestCase {
-
- static {
- SequenceTestSupport.stringAsSequence()
- }
-
- void "test IsAtat(): Valid"() {
- assert AtatPalindromeDetector.isAtat("ATATAT" as NucleicBuffer) == true
- assert AtatPalindromeDetector.isAtat("TATATA" as NucleicBuffer) == true
- assert AtatPalindromeDetector.isAtat("CGCGCG" as NucleicBuffer) == true
- assert AtatPalindromeDetector.isAtat("GCGCGC" as NucleicBuffer) == true
- }
-
- void "test IsAtat(): Invalid"() {
- assert AtatPalindromeDetector.isAtat("ATATTAT" as NucleicBuffer) == false
- assert AtatPalindromeDetector.isAtat("ATATCAT" as NucleicBuffer) == false
- }
-
- void "test findPalindrome in longer sequence"() {
- AtatPalindromeDetector detector = new AtatPalindromeDetector((4..6) as SortedSet, (2..3) as SortedSet)
- PalindromeMatcher matcher = detector.findPalindrome("CCATATATATATATATATATCC" as SequenceData)
- assert matcher.count == 1
-
- PalindromeModel palindrome = matcher.iterator().next()
- assert palindrome.sequence.toPlain() == "ATATAT"
- assert palindrome.opposite.toPlain() == "ATATAT"
- assert palindrome.spacer.toPlain() == "AT"
- assert palindrome.position == 2
- }
-
- void "test findPalindrome in longer sequence 2"() {
- AtatPalindromeDetector detector = new AtatPalindromeDetector((4..6) as SortedSet, (2..3) as SortedSet)
- PalindromeMatcher matcher = detector.findPalindrome("CCATATATATATATATATATACC" as SequenceData)
- assert matcher.count == 1
-
- PalindromeModel palindrome = matcher.iterator().next()
- assert palindrome.sequence.toPlain() == "ATATAT"
- assert palindrome.opposite.toPlain() == "ATATAT"
- assert palindrome.spacer.toPlain() == "AT"
- assert palindrome.position == 2
- }
-
- void "test findPalindrome in short sequence"() {
- AtatPalindromeDetector detector = new AtatPalindromeDetector((5..15) as SortedSet, (2..3) as SortedSet)
- PalindromeMatcher matcher = detector.findPalindrome("CCATATATATATATATATATATCC" as SequenceData)
- assert matcher.count == 1
-
- PalindromeModel palindrome = matcher.iterator().next()
- assert palindrome.sequence.toPlain() == "ATATATATAT"
- assert palindrome.opposite.toPlain() == "ATATATATAT"
- assert palindrome.spacer.length == 0
- assert palindrome.position == 2
- }
-
- void "test findPalindrome in short sequence 2"() {
- AtatPalindromeDetector detector = new AtatPalindromeDetector((5..15) as SortedSet, (2..3) as SortedSet)
- PalindromeMatcher matcher = detector.findPalindrome("CCATATATATATATATATATATACC" as SequenceData)
- assert matcher.count == 1
-
- PalindromeModel palindrome = matcher.iterator().next()
- assert palindrome.sequence.toPlain() == "ATATATATAT"
- assert palindrome.opposite.toPlain() == "ATATATATAT"
- assert palindrome.spacer.length == 0
- assert palindrome.position == 2
- }
-
- void "test findPalindrome in middle sequence"() {
- AtatPalindromeDetector detector = new AtatPalindromeDetector((5..7) as SortedSet, (3..7) as SortedSet)
- PalindromeMatcher matcher = detector.findPalindrome("CCATATATATATATATATATCC" as SequenceData)
- assert matcher.count == 1
-
- PalindromeModel palindrome = matcher.iterator().next()
- assert palindrome.sequence.toPlain() == "ATATATA"
- assert palindrome.opposite.toPlain() == "TATATAT"
- assert palindrome.spacer.toPlain() == "TATA"
- assert palindrome.position == 2
- }
-
- void "test findPalindrome in middle sequence 2"() {
- AtatPalindromeDetector detector = new AtatPalindromeDetector((5..7) as SortedSet, (3..7) as SortedSet)
- PalindromeMatcher matcher = detector.findPalindrome("CCATATATATATATATATATACC" as SequenceData)
- assert matcher.count == 1
-
- PalindromeModel palindrome = matcher.iterator().next()
- assert palindrome.sequence.toPlain() == "ATATATA"
- assert palindrome.opposite.toPlain() == "TATATAT"
- assert palindrome.spacer.toPlain() == "TATA"
- assert palindrome.position == 2
- }
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/CompositePalindromeModelDetectorTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/CompositePalindromeModelDetectorTest.groovy
deleted file mode 100644
index 5444bcd..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/CompositePalindromeModelDetectorTest.groovy
+++ /dev/null
@@ -1,126 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.detector
-
-
-import cz.mendelu.dnaAnalyser.analyse.palindrome.model.PalindromeModel
-import cz.mendelu.dnaAnalyser.sequence.data.SequenceData
-import spock.lang.Ignore
-import spock.lang.Specification
-
-/**
- * Created by Honza on 6. 10. 2015.
- */
-class CompositePalindromeModelDetectorTest extends Specification {
-
- static {
- SequenceTestSupport.stringAsSequence()
- }
-
- CompositePalindromeDetector detector = new CompositePalindromeDetector(null, null)
-
- def "test merge: Nocolision"() {
- given:
- SimplePalindromeDetector.SimplePalindromeMatcher a = new SimplePalindromeDetector.SimplePalindromeMatcher()
- a.add(new PalindromeModel("AAAAAAA" as SequenceData, 10, 7, 5, 3))
- SimplePalindromeDetector.SimplePalindromeMatcher b = new SimplePalindromeDetector.SimplePalindromeMatcher()
- b.add(new PalindromeModel("CCCCCCC" as SequenceData, 20, 7, 5, 3))
-
- when:
- PalindromeMatcher merge = detector.merge(a, b)
-
- then:
- merge.count == 2
- }
-
- def "test merge: ColisionReplace"() {
- given:
- PalindromeModel p7_5_3 = new PalindromeModel("AAAAAAA" as SequenceData, 10, 7, 5, 3)
- PalindromeModel p8_3_3 = new PalindromeModel("CCCCCCCC" as SequenceData, 10, 8, 3, 3)
-
- SimplePalindromeDetector.SimplePalindromeMatcher a = new SimplePalindromeDetector.SimplePalindromeMatcher()
- SimplePalindromeDetector.SimplePalindromeMatcher b = new SimplePalindromeDetector.SimplePalindromeMatcher()
-
- a.add(p7_5_3)
- b.add(p8_3_3)
-
- when:
- PalindromeMatcher merge = detector.merge(a, b)
-
- then:
- 1 == merge.count
- p8_3_3.equals(merge.stream().findFirst().get())
- }
-
- def "test merge: ColisionState"() {
- given:
- PalindromeModel p7_5_3 = new PalindromeModel("AAAAAAA" as SequenceData, 10, 7, 5, 3)
- PalindromeModel p8_3_3 = new PalindromeModel("CCCCCCCC" as SequenceData, 10, 8, 3, 3)
-
- SimplePalindromeDetector.SimplePalindromeMatcher a = new SimplePalindromeDetector.SimplePalindromeMatcher()
- SimplePalindromeDetector.SimplePalindromeMatcher b = new SimplePalindromeDetector.SimplePalindromeMatcher()
-
- a.add(p7_5_3)
- b.add(p8_3_3)
-
- when:
- PalindromeMatcher merge = detector.merge(b, a)
-
- then:
- 1 == merge.count
- p8_3_3.equals(merge.stream().findFirst().get())
- }
-
- @Ignore
- def "test Issue #47"() {
- given:
- SortedSet size = (15..20) as SortedSet
- SortedSet spacer = (0..10) as SortedSet
- SortedSet mismatches = (0..5) as SortedSet
- PalindromeDetector detector = CompositePalindromeDetector.palindromeDetectorBuilder().getPalindromeDetector(size, spacer, mismatches)
- and:
- SequenceData sequence = "AAAAAAAAAAAAAAAAAAAAGGGTTTTTTTTTTTTTTTTTTTT" as SequenceData
-
- when:
- PalindromeMatcher matcher = detector.findPalindrome(sequence)
-
- then:
- matcher.count == 1
- matcher.iterator().next().sequence == new Sequence("AAAAAAAAAAAAAAAAAAAA")
-
- }
-
- @Ignore
- def "test ATAT rich genome problem"() {
- given:
- SortedSet size = (5..8) as SortedSet
- SortedSet spacer = (0..3) as SortedSet
- SortedSet mismatches = (0..1) as SortedSet
- PalindromeDetector detector = CompositePalindromeDetector.palindromeDetectorBuilder().getPalindromeDetector(size, spacer, mismatches)
- and:
- SequenceData sequence = "GGATATATATATATATATATGG" as SequenceData
-
- when:
- PalindromeMatcher matcher = detector.findPalindrome(sequence)
-
- then:
- matcher.count == 1
- matcher.iterator().next().sequence.toPlain() == "ATATATATA"
-
- }
-
- @Ignore
- def "test NNNNNN sequence should not be found"() {
- given:
- SortedSet size = (6..30) as SortedSet
- SortedSet spacer = (0..10) as SortedSet
- SortedSet mismatches = (0..1) as SortedSet
- PalindromeDetector detector = CompositePalindromeDetector.palindromeDetectorBuilder().getPalindromeDetector(size, spacer, mismatches)
- and:
- SequenceData sequence = "GGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGG" as SequenceData
-
- when:
- PalindromeMatcher matcher = detector.findPalindrome(sequence)
-
- then:
- matcher.count == 0
- }
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/PalindromeTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/PalindromeTest.groovy
deleted file mode 100644
index 0d64738..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/PalindromeTest.groovy
+++ /dev/null
@@ -1,41 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.detector
-/**
- * Created by xkoloma1 on 21.08.2015.
- */
-class PalindromeTest /*extends GroovyTestCase*/ {
-
- static {
- //SequenceTestSupport.stringAsSequence()
- }
-
-// @Ignore
-// void testConstructor() {
-// PalindromeModel palindrome = new PalindromeModel("ABCDEFGHIJKLMNOPQRSTUVWXZ" as Sequence, 8, 4, 2, 0);
-// assert palindrome.before == "DEFGH" as Sequence;
-// assert palindrome.sequence == "IJKL" as Sequence;
-// assert palindrome.spacer == "MN" as Sequence;
-// assert palindrome.opposite == "OPQR" as Sequence;
-// assert palindrome.after == "STUVW" as Sequence;
-// }
-
- // @Ignore
- // void testIterator() {
-// PalindromeModel palindrome = new PalindromeModel("ACGCGCCCTGTAGCGGCGCAT" as Sequence, 0, 7, 7, 1);
-// Iterator<PalindromeModel.Entry> i = palindrome.iterator();
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.A, cz.mendelu.genetika.genoms.Genome.Nuclid.T);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.C, cz.mendelu.genetika.genoms.Genome.Nuclid.A);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.G, cz.mendelu.genetika.genoms.Genome.Nuclid.C);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.C, cz.mendelu.genetika.genoms.Genome.Nuclid.G);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.G, cz.mendelu.genetika.genoms.Genome.Nuclid.C);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.C, cz.mendelu.genetika.genoms.Genome.Nuclid.G);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.C, cz.mendelu.genetika.genoms.Genome.Nuclid.G);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.C);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.T);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.G);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.T);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.A);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.G);
-// assert i.next() == new PalindromeModel.Entry(cz.mendelu.genetika.genoms.Genome.Nuclid.C);
-// assert i.hasNext() == false;
-// }
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SequenceTestSupport.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SequenceTestSupport.groovy
deleted file mode 100644
index 66fe4f8..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SequenceTestSupport.groovy
+++ /dev/null
@@ -1,40 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.detector
-
-import cz.mendelu.dnaAnalyser.sequence.NucleicBuffer
-import cz.mendelu.dnaAnalyser.sequence.Sequence
-import cz.mendelu.dnaAnalyser.sequence.data.SequenceData
-
-class SequenceTestSupport extends GroovyTestCase {
-
- static stringAsSequence() {
- String.metaClass.define {
- oldAsType = String.metaClass.getMetaMethod("asType", [Class] as Class[])
- asType = { Class c ->
- if (c == SequenceData) {
- SequenceData.wrap(new Sequence(
- id: UUID.randomUUID(),
- circular: false),
- delegate.bytes)
- } else if (c == NucleicBuffer) {
- SequenceData.wrap(new Sequence(
- id: UUID.randomUUID(),
- circular: false),
- delegate.bytes)
- .iterator()
- } else {
- oldAsType.invoke(delegate, c)
- }
- }
- }
- }
-
- void testConvertSequenceData() {
- def s = "ACTG" as SequenceData
- assert s instanceof SequenceData
- }
-
- void testConvertNucleicBuffer() {
- def s = "ACTG" as NucleicBuffer
- assert s instanceof NucleicBuffer
- }
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/Simple2PalindromeDetectorTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/Simple2PalindromeDetectorTest.groovy
deleted file mode 100644
index 58d1472..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/Simple2PalindromeDetectorTest.groovy
+++ /dev/null
@@ -1,91 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.detector
-/**
- * Created by xkoloma1 on 27. 7. 2015.
- */
-
-class Simple2PalindromeDetectorTest /*extends groovy.util.GroovyTestCase*/ {
-
- static {
- SequenceTestSupport.stringAsSequence()
- }
-
-// @Ignore
-// void testFindPalindrome() {
-// PalindromeDetector detector = new Simple2PalindromeDetector(5, (0..5) as SortedSet, (0..3) as SortedSet);
-// PalindromeMatcher matcher = detector.findPalindrome("CCCCCAAAAACTTTTTCCCCCCCCCCCCCCTTTTTCCCAAGAACCCCC" as Sequence);
-// Iterator<PalindromeModel> iterator = matcher.iterator();
-// PalindromeModel palindrome;
-//
-// assert matcher.count == 2;
-//
-// palindrome = iterator.next();
-// assert palindrome.sequence == "AAAAA" as Sequence;
-// assert palindrome.opposite == "TTTTT" as Sequence;
-// assert palindrome.position == 5;
-// assert palindrome.spacer.length == 1;
-// assert palindrome.mismatches == 0;
-//
-// palindrome = iterator.next();
-// assert palindrome.sequence == "TTTTT" as Sequence;
-// assert palindrome.opposite == "AAGAA" as Sequence;
-// assert palindrome.position == 30;
-// assert palindrome.spacer.length == 3;
-// assert palindrome.mismatches == 1;
-// }
-
-// @Ignore
-// void testFindPalindrome_RNA() {
-// PalindromeDetector detector = new Simple2PalindromeDetector(5, (0..5) as SortedSet, (0..3) as SortedSet);
-// PalindromeMatcher matcher = detector.findPalindrome("CCCCCAAAAACUTUUUCCCCCCCCCCCCCCUUUUUCCCAAGAACCCCC" as Sequence);
-// Iterator<PalindromeModel> iterator = matcher.iterator();
-// PalindromeModel palindrome;
-//
-// assert matcher.count == 2;
-//
-// palindrome = iterator.next();
-// assert palindrome.sequence == "AAAAA" as Sequence;
-// assert palindrome.opposite == "UTUUU" as Sequence;
-// assert palindrome.position == 5;
-// assert palindrome.spacer.length == 1;
-// assert palindrome.mismatches == 0;
-//
-// palindrome = iterator.next();
-// assert palindrome.sequence == "UUUUU" as Sequence;
-// assert palindrome.opposite == "AAGAA" as Sequence;
-// assert palindrome.position == 30;
-// assert palindrome.spacer.length == 3;
-// assert palindrome.mismatches == 1;
-// }
-
-// @Ignore
-// void testFindPalindrome_Whole() {
-// PalindromeDetector detector = new Simple2PalindromeDetector(4, (0..5) as SortedSet, (0..3) as SortedSet);
-// PalindromeMatcher matcher = detector.findPalindrome("AAAATTTT" as Sequence);
-// assert matcher.count == 1;
-//
-// PalindromeModel palindrome = matcher.iterator().next();
-// assert palindrome.sequence == "AAAA" as Sequence;
-// assert palindrome.position == 0;
-// assert palindrome.spacer.length == 0;
-// assert palindrome.mismatches == 0;
-// }
-
-// @Ignore
-// void testCyclePalindrome() {
-// PalindromeDetector detector = new Simple2PalindromeDetector(10, (0..0) as SortedSet, (0..0) as SortedSet);
-// detector.setCycleMode(true);
-// PalindromeMatcher matcher = detector.findPalindrome("TGCCTNAGGCATGTCTAGACA" as Sequence);
-// Iterator<PalindromeModel> iterator = matcher.iterator();
-// PalindromeModel palindrome;
-//
-// assert matcher.count == 1;
-//
-// palindrome = iterator.next();
-// assert palindrome.sequence == "AGGCATGTCT" as Sequence;
-// assert palindrome.opposite == "AGACATGCCT" as Sequence;
-// assert palindrome.position == 6;
-// assert palindrome.spacer.length == 0;
-// assert palindrome.mismatches == 0;
-// }
-
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SimplePalindromeDetectorTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SimplePalindromeDetectorTest.groovy
deleted file mode 100644
index dc1712b..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/detector/SimplePalindromeDetectorTest.groovy
+++ /dev/null
@@ -1,74 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.detector
-/**
- * Created by xkoloma1 on 27. 7. 2015.
- */
-
-class SimplePalindromeDetectorTest /*extends groovy.util.GroovyTestCase*/ {
-
- static {
- SequenceTestSupport.stringAsSequence()
- }
-
-// @Ignore
-// void testFindPalindrome() {
-// PalindromeDetector detector = new SimplePalindromeDetector(7,4,0);
-// PalindromeMatcher matcher = detector.findPalindrome("GAACATGTCCCAACATGTTG" as SequenceData);
-// assert matcher.count == 1;
-//
-// PalindromeModel palindrome = matcher.iterator().next();
-// assert palindrome.sequence == "AACATGT" as Sequence;
-// assert palindrome.opposite == "ACATGTT" as Sequence;
-// assert palindrome.position == 1;
-// }
-//
-// @Ignore
-// void testFindPalindrome2() {
-// PalindromeDetector detector = new SimplePalindromeDetector(10,0,0);
-// PalindromeMatcher matcher = detector.findPalindrome("GAGACATGCCTAGGCATGTCTG" as SequenceData);
-// assert matcher.count == 1;
-//
-// PalindromeModel palindrome = matcher.iterator().next();
-// assert palindrome.sequence == "AGACATGCCT" as Sequence;
-// assert palindrome.opposite == "AGGCATGTCT" as Sequence;
-// assert palindrome.position == 1;
-// }
-//
-// @Ignore
-// void testFindPalindrome3() {
-// PalindromeDetector detector = new SimplePalindromeDetector(8,6,0);
-// PalindromeMatcher matcher = detector.findPalindrome("AACGCGGAGACATGCCTGGGGGGAGGCATGTCTGGGCGGG" as SequenceData);
-// assert matcher.count == 1;
-//
-// PalindromeModel palindrome = matcher.iterator().next();
-// assert palindrome.sequence == "ACATGCCT" as Sequence;
-// assert palindrome.opposite == "AGGCATGT" as Sequence;
-// assert palindrome.position == 9;
-// }
-//
-// @Ignore
-// void testFindPalindrome_Whole() {
-// PalindromeDetector detector = new SimplePalindromeDetector(4,0,0);
-// PalindromeMatcher matcher = detector.findPalindrome("AAAATTTT" as SequenceData);
-// assert matcher.count == 1;
-//
-// PalindromeModel palindrome = matcher.iterator().next();
-// assert palindrome.sequence == "AAAA" as Sequence;
-// assert palindrome.position == 0;
-// }
-//
-// @Ignore
-// void testFindPalindrome_Mismatche() {
-// PalindromeDetector detector = new SimplePalindromeDetector(4,0,1);
-// PalindromeMatcher matcher = detector.findPalindrome("AAAATTCT" as SequenceData);
-// assert matcher.count == 1;
-//
-// PalindromeModel palindrome = matcher.iterator().next();
-// assert palindrome.sequence == "AAAA" as Sequence;
-// assert palindrome.opposite == "TTCT" as Sequence;
-// assert palindrome.position == 0;
-//
-// }
-//
-
-
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/model/NumberRangeTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/model/NumberRangeTest.groovy
deleted file mode 100644
index b3a1b6d..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/model/NumberRangeTest.groovy
+++ /dev/null
@@ -1,32 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.model
-
-/**
- * Created by xkoloma1 on 28. 7. 2015.
- */
-class NumberRangeTest extends GroovyTestCase {
-
- void testGetValues_SingleValue() {
- NumberRange range = new NumberRange("1")
- assert range.values == new TreeSet<>([1])
- }
-
- void testGetValues_MultipleValues() {
- NumberRange range = new NumberRange("1,2")
- assert range.values == new TreeSet<>([1, 2])
- }
-
- void testGetValues_SingleRange() {
- NumberRange range = new NumberRange("1-3")
- assert range.values == new TreeSet<>([1, 2, 3])
- }
-
- void testGetValues_MultipleRanges() {
- NumberRange range = new NumberRange("1-3, 5-7")
- assert range.values == new TreeSet<>([1, 2, 3, 5, 6, 7])
- }
-
- void testGetValues_FullMix() {
- NumberRange range = new NumberRange("1-3, 5")
- assert range.values == new TreeSet<>([1, 2, 3, 5])
- }
-}
diff --git a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/stability/NNModelStabilityCalculatorTest.groovy b/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/stability/NNModelStabilityCalculatorTest.groovy
deleted file mode 100644
index 784ce69..0000000
--- a/src/test/groovy/cz/mendelu/dnaAnalyser/analyse/palindrome/stability/NNModelStabilityCalculatorTest.groovy
+++ /dev/null
@@ -1,25 +0,0 @@
-package cz.mendelu.dnaAnalyser.analyse.palindrome.stability
-
-import cz.mendelu.dnaAnalyser.analyse.palindrome.detector.SequenceTestSupport
-import cz.mendelu.dnaAnalyser.analyse.palindrome.model.PalindromeModel
-import cz.mendelu.dnaAnalyser.sequence.data.SequenceData
-
-/**
- * Created by Honza on 20.11.2015.
- */
-class NNModelStabilityCalculatorTest extends GroovyTestCase {
-
- static {
- SequenceTestSupport.stringAsSequence()
- }
-
- NNModelStabilityCalculator calculator = new NNModelStabilityCalculator()
-
- void testCalculate() {
- PalindromeModel palindrome = new PalindromeModel("CGTTGATCAACG" as SequenceData, 0, 6, 0, 0)
- double value = calculator.calculateCruciForm(palindrome)
- assert value == -5.35
- }
-
- // TODO otestovat na mfoold;
-}
--
GitLab